Slot: first ribosomal sequence (isolate_ribosomal_seq)

Primary ribosomal sequence for strain verification. For microbial drafts must be >1300 nt; for single cells >220 bp with <10% Ns; for fungal ITS >450 nt with <2% Ns. Use only A, C, G, T, or N with no FASTA header line.

URI: nmdc_sub_schema:isolate_ribosomal_seq Alias: isolate_ribosomal_seq

Applicable Classes

Name	Description	Modifies Slot
JgiIsolateGenomeInterface	JGI submission metadata for isolate GENOME sequencing projects	yes

Properties

Range: String
Recommended: True
Regex pattern: ^[ATCGN]{200,5000}$

Aliases

First ribosomal sequence

Examples

Value
AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACT

Comments

At least one ribosomal sequence is required for strain verification and must come from the actual sample to be shipped to JGI. Please use only A, C, G, T or N, with no header. Sequence of insufficient quality may delay the completion of the project. 16s sequence is required for all microbial drafts and single cells. For microbial drafts, sequence MUST be >1300 nt; for single cells the sequence MUST be >220 bp, with <10% Ns.
ITS sequence is required for all samples for fungal drafts for strain verification. ITS sequence must be >450 nt with <2% Ns.

Identifier and Mapping Information

Schema Source

from schema: https://example.com/nmdc_submission_schema

Mappings

Mapping Type	Mapped Value
self	nmdc_sub_schema:isolate_ribosomal_seq
native	nmdc_sub_schema:isolate_ribosomal_seq

LinkML Source

name: isolate_ribosomal_seq
description: Primary ribosomal sequence for strain verification. For microbial drafts
  must be >1300 nt; for single cells >220 bp with <10% Ns; for fungal ITS >450 nt
  with <2% Ns. Use only A, C, G, T, or N with no FASTA header line.
title: first ribosomal sequence
notes:
- JGI requires the ribosomal sequence for draft genome products but not for resequencing,
  methylation, or transcriptome products. submission-schema does not enforce that
  as a rule because the requirement keys on the JGI Sequencing Product, which the
  schema does not carry as a slot. Tracked in https://github.com/microbiomedata/nmdc-server/issues/2177.
- The product-specific length and N-content thresholds in the description (>1300 nt
  microbial drafts, >220 bp <10% Ns single cells, >450 nt <2% Ns fungal ITS) are not
  enforced; the flat pattern checks only 200-5000 A/C/G/T/N. Product-aware checks
  would live in nmdc-server (validation.ts).
comments:
- At least one ribosomal sequence is required for strain verification and must come
  from the actual sample to be shipped to JGI.  Please use only A, C, G, T or N, with
  no header.  Sequence of insufficient quality may delay the completion of the project.
  16s sequence is required for all microbial drafts and single cells.  For microbial
  drafts, sequence MUST be >1300 nt; for single cells the sequence MUST be >220 bp,
  with <10% Ns.
- ITS sequence is required for all samples for fungal drafts for strain verification.
  ITS sequence must be >450 nt with <2% Ns.
examples:
- value: AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACT
from_schema: https://example.com/nmdc_submission_schema
aliases:
- First ribosomal sequence
rank: 32
alias: isolate_ribosomal_seq
domain_of:
- JgiIsolateGenomeInterface
range: string
recommended: true
pattern: ^[ATCGN]{200,5000}$